Submitting Sequences¶
Submission of genomes/consensus sequences can only be achieved through Webin-CLI. There is no XML-based option.
Webin-CLI¶
As with read submission, submission of sequences through the Webin-CLI utility requires manifest files providing information about the data files. Using the -context genome
we usually provide metadata about how the sequence was generated and from which platforms the underlying data originated.
In the sequences/webin-cli
directory, we provide all example files required to submit sequences against our 3 samples.
cd $WORKSHOP/sequences/webin-cli
ls
For each of our 3 samples, you will find:
a
*_manifest.txt
file defining information about the sequence, including the name of the fasta file containing the sequencea
*.fasta.gz
file : a fasta file containing the sequence data. This file must be compressed for submissiona
*_chrm_list.txt.gz
file : defining the list of ‘chromosomes’. In the case of SARS-CoV-2, we simply list the sequences as ‘chromosome 1’ . This file must also be compressed
Each of the manifest files will need to be edited to add your own accessions in order to link these sequences to your existing objects. The following lines should be customised:
STUDY PRJEB#####
SAMPLE ERS#######
RUN_REF ERR#######
Note
Where possible, we recommend including a RUN_REF
to link the sequence back to the raw read data it was built from.
As we did with reads, we will first validate our submission using the -validate
flag.
java -jar webin-cli-4.2.0.jar -context genome -manifest hCoV-19_isolate_1_manifest.txt -userName user -password pass -test -validate
If this passes validation, we can replace the -validate
flag with -submit
to perform the submission.
Warning
Please use the -test
flag to submit to our test service
java -jar webin-cli-4.2.0.jar -context genome -manifest hCoV-19_isolate_1_manifest.txt -userName user -password pass -test -submit
Webin-CLI-REST¶
A new JSON-based REST service was introduced this year specifically for the submission of SARS-CoV-2 sequences. In this service, sequences are not held in fasta files - rather, they are included directly in the JSON payload itself, greatly simplifying the process of submission. This is only possible due to the small size and relatively low complexity of the genome. For more information on this system, including useful code snippets, please see our documentation here.
cd $WORKSHOP/sequences/webin-cli-rest/
ls
cat hCoV-19_isolate_1.json
Note that this JSON object contains the exact same information as that of its equivalent manifest file. The only difference is that the sequence is embedded directly into the JSON payload. We will send the entire JSON object via the POST
protocol to our Webin-CLI-REST (test) service using cURL.
This service also provides both validation and submission services, as with the Webin-CLI tool, but here we POST
to different URLs for each service:
validation: https://wwwdev.ebi.ac.uk/ena/submit/webin-cli/api/v1/genome/covid-19/validate
submission: https://wwwdev.ebi.ac.uk/ena/submit/webin-cli/api/v1/genome/covid-19
Let’s validate the contents of hCoV-19_isolate_1.json
. Remember to replace -u user:pass
with your webin credentials, and to substitute in your own accessions into the JSON object:
curl -X 'POST' -u user:pass \
'https://wwwdev.ebi.ac.uk/ena/submit/webin-cli/api/v1/genome/covid-19/validate' \
-H 'accept: application/json' \
-H 'Content-Type: application/json' \
-d '{
"study": "PRJEB#####",
"sample": "ERS#######",
"runRef": "ERR#######",
"name": "hCov-19_isolate_1",
"coverage": 100,
"program": "ARTIC fieldbioinformatics (minimap2/nanopolish) 1.1.3 (nanopolish 0.13.2)",
"platform": "ILLUMINA",
"minGapLength": 3,
"moleculeType": "genomic RNA",
"description": "example sequence #1 for workshop",
"sequence": "NNNNNNNNNTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGATGCTCGACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGG"
}'
To submit the sequence, simply remove /validate
from the URL above and run again.
Sequence Distribution¶
Sequences are submitted to ENA as analysis objects, as covered in the metadata model video. Once processed, they will be distributed as EMBL flat files. For an example of this format, see here. Largely, it is composed of:
metadata such as authors and addresses (contained in lines beginning with
R
, e.g.RA
,RL
,RG
)sample information inside a
source
blockthe sequence itself
Upon generation of the EMBL file, sequences also acquire a sequence accession, which takes the format of 2 upper case letters & 6 numbers, e.g. LR991698
Tip
Next, we’ll take a quick look at the drag-and-drop uploader tool, which is capable of submitting all data types already covered in a single step!